NEB, E1610S, EpiMark® N6-Methyladenosine Enrichment Kit
The Epimark
Catalog Number: E1610S
Send an RFQ.
Category
Loading…
| <b>Materials Required but not Supplied</b> Reaction Buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40 in nuclease free H 2 O) Protein G Magnetic Beads (NEB #S1430) Magnetic Racks for bead separations (NEB #S1506 or #S1509) Monarch ® RNA Cleanup Kit (10 µg) ( NEB #T2030 ) 100% Ethanol 70% Ethanol Eppendorf ® RNA/DNA LoBind microcentrifuge tubes (Sigma catalog #Z666548) or equivalent RNase-free pipette tips Powder-free gloves Nuclease-free water Optional Materials Primers for amplification of control RNAs | GLuc Forward Primer = 5´- CGACATTCCTGAGATTCCTGG - 3´ GLuc Reverse Primer = 5´- TTGAGCAGGTCAGAACACTG - 3´ CLuc Forward Primer = 5´- GCTTCAACATCACCGTCATTG - 3´ CLuc Reverse Primer = 5´- CACAGAGGCCAGAGATCATTC - 3´ ProtoScript ® II First Strand cDNA Synthesis Kit (NEB #E6560) Bio-Rad iTaq™ Universal SYBR ® Green Supermix (cat. #172-5120) 384 well PCR plate (Bio-Rad cat. #HSP-3805) Optical film (Bio-Rad cat. #MSB-1001) |
|---|
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
