Qiagen, 940014, BioSprint 15 DNA Blood Kit (45)
Catalog Number: 940014
Send an RFQ.
Category
Loading…
Send an RFQ for Qiagen 940014, BioSprint 15 DNA Blood Kit (45). Iright supports global sourcing and international shipment for life science and laboratory products.
| Brand | BD™ AbSeq |
|---|---|
| Alternative Name | CCR7, BLR-2, EBI-1, CMKBR7 |
| Entrez Gene ID | 1236 |
| Vol. Per Test | 2 µl |
| Isotype | Rat IgG2a, κ |
| Reactivity | Human (Tested in Development) |
| Application | Single Cell 3' Sequencing (Qualified) |
| Barcode Sequence | AAGGGTTGTAAGTTAGTCGATCCGCGTATTGTCATG |
| Sequence ID | AHS0007 |
| Immunogen | Human CCR7 protein |
| Storage Buffer | Aqueous buffered solution containing BSA and ≤0.09% sodium azide. |
| Regulatory Status | RUO |
| Host Species | Rat |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
