Beckman Coulter, 302359, Aluminum Tube Cap Assembly (25.0 mm)
Catalog Number: 302359
Send an RFQ.
Category
Loading…
| Verified Reactivity | Human, Cynomolgus, Rhesus |
|---|---|
| Reported Reactivity | Baboon, Capuchin Monkey, Chimpanzee, Pigtailed Macaque, Squirrel Monkey |
| Antibody Type | Monoclonal |
| Host Species | Mouse |
| Immunogen | Human tonsillar B cells |
| Formulation | Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA |
| Preparation | The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. |
| Concentration | 0.5 mg/ml |
| Storage & Handling | The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze. |
| Application | PG - Quality tested |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
| Recommended Usage |
|---|
| Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. |
| Application Notes | The epitope recognized by clone 2H7 has been mapped to the sequence YNCEPANPSEKNSPST which lies in the large extracellular loop of human CD20. Additional reported applications (for the relevant formats) include: immunoprecipitation4 and immunohistochemical staining of acetone-fixed frozen sections5. |
|---|
| Additional Product Notes | TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq. The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Scientific Poster Library. |
|---|
| Application References(PubMed link indicates BioLegend citation) | Schlossman S, et al. 1995. Leucocyte Typing V. Oxford University Press. New York. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York. McMichael A, et al. Eds. 1987. Leucocyte Typing III Oxford University Press. New York. Polyak MJ, et al. 2002. Blood 99:3256. (IP) Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC) |
|---|
| Product Citations | Leader AM, et al. 2021. Cancer Cell. 39:1594. PubMed Cadot S, et al. 2020. Biomark Res. 0.383333333. PubMed Witkowski MT, et al. 2020. Cancer Cell. 37:867. PubMed Hao Y, et al. 2021. Cell. 184:3573. PubMed |
|---|
| RRID | AB_2749984 (BioLegend Cat. No. 302359) |
|---|
| Structure | Four transmembrane protein (TM4SF), heavily phosphorylated after activation, 33-37 kD |
|---|
| Distribution | B cell, T cell subsets |
|---|
| Function | B cell activation |
|---|
| Ligand/Receptor | Src family tyrosine kinases, MHC class I, II, CD53, CD81, CD82 |
|---|
| Cell Type | B cells, T cells |
|---|
| Biology Area | Costimulatory Molecules, Immunology |
|---|
| Molecular Family | CD Molecules |
|---|
| Antigen References | 1. Hultin L, et al. 1993. Cytometry 14:196. 2. Tedder T, et al. 1994. Immunol. Today 15:450. |
|---|
| Gene ID | 931 |
|---|
| UniProt | View information about CD20 on UniProt.org |
|---|
| Clone | 2H7 |
|---|
| Regulatory Status | RUO |
|---|
| Workshop | IV B201 |
|---|
| Other Names | B1, Bp35 |
|---|
| Isotype | Mouse IgG2b, κ |
|---|
| Barcode Sequence | TTCTGGGTCCCTAGA |
|---|
