Beckman Coulter, 394627, Biomek Tips P250 Span-8 Conductive Sterile Filtered
Catalog Number: 394627
Loading…
Send an RFQ for Beckman Coulter 394627, Biomek Tips P250 Span-8 Conductive Sterile Filtered. Iright supports global sourcing and international shipment for life science and laboratory products.
| Verified Reactivity | Human |
|---|---|
| Antibody Type | Monoclonal |
| Host Species | Mouse |
| Formulation | Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA |
| Preparation | The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. |
| Concentration | 0.5 mg/ml |
| Storage & Handling | The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze. |
| Application | PG - Quality tested |
| Recommended Usage | Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
| Additional Product Notes | The TotalSeq™-A Hashtag reagents require different primers than regular TotalSeq™ antibodies. Please refer to the protocol for details. TotalSeq™ Hashtag reagents can be used for multiplexing different samples; optimization of microfluidics instruments to load a high number of cells, and discriminate droplets containing more than one cell; performing TotalSeq™ antibody titrations, etc. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/en-us/totalseq. The barcode flanking sequences are GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Scientific Poster Library. |
|---|
| Product Citations | McFarland JM, et al. 2020. Nat Commun. 4296:11. PubMed Benjamin Krämer, et al. 2021. Immunity.. Online ahead of print. PubMed Genge PC, et al. 2021. STAR Protoc. 2:100900. PubMed |
|---|
| RRID | AB_2750027 (BioLegend Cat. No. 394627) |
|---|
| Gene ID | 483567 |
|---|
| UniProt | View information about CD298/beta2-microglobulin on UniProt.org |
|---|
| Clone | LNH-94; 2M2; |
|---|
| Regulatory Status | RUO |
|---|
| Other Names | Na+/K+ ATPase β3, ATP1B3, β2M, β2-M, beta2-microglobulin b2-M, b2M |
|---|
| Isotype | Mouse IgG1, κ (all clones) |
|---|
| Barcode Sequence | CTGTATGTCCGATTG |
|---|
