Description
This reagent is provided lyophilized in a pre-titrated format. 1. Remove the BD® OMICS-One T-Cell Protein Panel tube from the foil bag and bring up to room temperature for 5 minutes. 2. Make sure the pellet is located at the bottom of the tube. If not, briefly centrifuge to collect the contents at the tube bottom. 3. Add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibodies immediately before cell staining. Prolonged incubation of reconstituted antibody might increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 60 plex or lower, prepare the BD® AbSeq labeling MasterMix in a 1.5-mL LoBind tube on ice. Note: For drop-in with more than 60 plex, reach out to technical support for calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS† (catalog number 554656) 140 – (2.0 x N) 182 – (2.6 x N) 364 – (5.2 x N) Total 140 182 364 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS† (catalog number 554656) 120 – (2.0 × N) 156 – (2.6 × N) 312 – (5.2 × N) Total 120 156 312 * N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. † FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, add 140 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 35 µL reconstituted T-Cell Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, add 120 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing 35 µL reconstituted T-Cell Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. Otherwise, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (Cat. No. 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component 1 sample (µL)* 1 sample + 20% overage (µL) FBS† (catalog number 554656) 20.0 24.0 Fc Block‡ (catalog number 564220) 5.0 6.0 Total 25.0 30.0 * Sufficient for up to 1 million cells. To block more cells, adjust the volume. † FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block = BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 µL. Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 x g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. See BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8 minute incubation) as follows: a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. Place the cartridge on the BD Rhapsody™ HT Xpress and perform the following operations: _____________________________________________________________ Material to load Volume (µL) 1 lane Pipette Mode Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One T-Cell panel: _____________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence CD103 Ber-ACT8 AHS0001 AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT CD137 4B4-1 AHS0003 TGACAAGCAACGAGCGATACGAAAGGCGAAATTAGT CD45RA HI100 AHS0009 AAGCGATTGCGAAGGGTTAGTCAGTACGTTATGTTG CD69 FN50 AHS0010 CAATAACGGGTCATAGTAAGTCGCGAGTAAGAGGGC CD278 DX29 AHS0012 ATAGTCCGCCGTAATCGTTGTGTCGCTGAAAGGGTT CD134 (OX40) ACT35 AHS0013 GGTGTTGGTAAGACGGACGGAGTAGATATTCGAGGT CD279 (PD-1) EH12.1 AHS0014 ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD366 (TIM-3) 7D3 AHS0016 TAGGTAGTAGTCCCGTATATCCGATCCGTGTTGTTT CD223 (Lag3) T47-530 AHS0018 CGGCATGAATTAGGCGAGACTTAGTATACGAGCTGG CD95 (Fas) DX2 AHS0023 GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD25 2A3 AHS0026 AGTTGTATGGGTTAGCCGAGAGTAGTGCGTATGATT CD127 HIL-7R-M21 AHS0028 AGTTATTAGGCTCGTAGGTATGTTTAGGTTATCGCG CD183 1C6/CXCR3 AHS0031 AAAGTGTTGGCGTTATGTGTTCGTTAGCGGTGTGGG CD4 SK3 AHS0032 TCGGTGTTATGAGTAGGTCGTCGTGCGGTTTGATGT CD196 (CCR6) 11A9 AHS0034 ACGTGTTATGGTGTTGTTCGAATTGTGGTAGTCAGT CD45RO UCHL1 AHS0036 TGAGAGGTTATTGGGCGTATGACTTCGGTGATTGTG CD194 (CCR4) 1G1 AHS0038 AATATTAGTGGGTCCTCGCGTTGGCCGGTTGTTAGT CD62L DREG-56 AHS0049 ATGGTAAATATGGGCGAATGCGGGTTGTGCTAAAGT CD272 J168-540 AHS0052 GTAGGTTGATAGTCGGCGATAGTGCGGTTGAAAGCT CD154 TRAP1 AHS0077 TAAGAGGTAAGTGCATTCGGGTATAGGCGTGATTTG CD357 (GITR) V27-580 AHS0104 TCTGTGTGTCGGGTTGAATCGTAGTGAGTTAGCGTG CD28 L293 AHS0138 TTGTTGAGGATACGATGAAGCGGTTTAAGGGTGTGG TCRgd 11F2 AHS0142 CTCGTGGGTTAGGCTTGATCGTAGTTATGTATGGTT CD44 L178 AHS0167 GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG TCR Va24-Ja18 6B11 AHS0175 TTCTGGTTCGGTTGAGCTACTAATTTCGTTGGATGG CD161 (KLRB1) HP-3G10 AHS0205 TTTAGGACGATTAGTTGTGCGGCATAGGAGGTGTTC CD8 SK1 AHS0228 AGGACATAGAGTAGGACGAGGTAGGCTTAAATTGCT CD3 UCHT1 AHS0231 AGCTAGGTGTTATCGGCAAGTTGTACGGTGAAGTCG CD197 (CCR7) 2-L1-A AHS0273 AATGTGTGATCGGCAAAGGGTTCTCGGGTTAATATG TIGIT tgMab-2 AHS0411 AGAGGGTTTAGTCAAGGTCGTGCGTATAGTTCAGGT
Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
1. This reagent is provided lyophilized in a pre-titrated format.
2. Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses.
5. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste.
6. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
7. For U.S. patents that may apply, see bd.com/patents.
8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
