Description
This reagent is provided lyophilized in a pre-titrated format. 1. Remove the BD® OMICS-One B-Cell Protein Panel tube from the foil bag and bring up to room temperature for 5 minutes. 2. Make sure the pellet is located at the bottom of the tube. If not, briefly centrifuge to collect the contents at the tube bottom. 3. Add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibodies immediately before cell staining. Prolonged incubation of reconstituted antibody might increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 60 plex or lower, prepare the BD® AbSeq labeling MasterMix using the procedure in the following two tables in 1.5-mL LoBind tube on ice. Note: For drop-in with more than 60 plex, reach out to technical support for calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS† (catalog number 554656) 140 – (2.0 x N) 182 – (2.6 x N) 364 – (5.2 x N) Total 140 182 364 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS† (catalog number 554656) 120 – (2.0 × N) 156 – (2.6 × N) 312 – (5.2 × N) Total 120 156 312 * N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. † FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, add 140 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 35 µL reconstituted B-Cell Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, add 120 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing 35 µL reconstituted B-Cell Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. Otherwise, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (catalog number 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component 1 sample (µL)* 1 sample + 20% overage (µL) FBS† (catalog number 554656) 20.0 24.0 Fc Block‡ (catalog number 564220) 5.0 6.0 Total 25.0 30.0 * Sufficient for up to 1 million cells. To block more cells, adjust the volume. † FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block = BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15 °C to 25 °C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 µL.Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 × g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of 3 washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing steps described below. See BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8-minute incubation) as follows: a) At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b) Place the cartridge on the BD Rhapsody™ HT Xpress and perform the following steps: _____________________________________________________________ Material to load Volume (µL) 1 lane Pipette Mode Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash c) (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One B-Cell Panel: _____________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence CD20 2H7 AHS0008 TTGCTTGTTGCGCGTTAGAGAGTATGTCGGGAGATG CD275 2D3/B7-H2 AHS0011 GTTTATATGTACGACGCCCGGTTGACGAGTGGAAGT CD38 HIT2 AHS0022 GTCAACGATGGGTAGCGGTAGAAATAACGGAACTGG CD95 DX2 AHS0023 GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD27 M-T271 AHS0025 TGTCCGGTTTAGCGAATTGGGTTGAGTCACGTAGGT CD19 SJ25C1 AHS0030 TAGTAATGTGTTCGTAGCCGGTAATAATCTTCGTGG HLA-DR G46-6 AHS0035 TGTTGGTTATTCGTTAGTGCATCCGTTTGGGCGTGG CD185 (CXCR5) RF8B2 AHS0039 AGGAAGGTCGATTGTATAACGCGGCATTGTAACGGC CD24 ML5 AHS0042 ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT CD80 L307.4 AHS0046 GAGGGTAACGGGTGTCCAAATATCGGCTGTGTAAGT CD5 UCHT2 AHS0047 ACGAAGCGAGCGAAGAACCTATGCGATTGAGTAAGT CD10 HI10a AHS0051 CCTGTTTGATGCGTACGGAGATTTAGCGGATTTATG IgD IA6-2 AHS0058 TGAGGGATGTATAGCGAGAATTGCGACCGTAGACTT IgG G18-145 AHS0059 AGGTAGGTTATCGTAGGGTAGACTTAGCGGGCATTG CD184 (CXCR4) 12G5 AHS0060 CAGTGTTTAGAGCGGGTTGCATATGTCGTTTAGAGG CD34 581 AHS0061 TGGGTGTATTACGGTTAGTTTATGCGCGAAGGTGTT CD21 B-ly4 AHS0074 GTATTCGCGTATTGTCAGTCGGTAGGGTTATGGTCT CD9 M-L13 AHS0082 GGGTTGTAAGTCGTCGGAAGTGTGAAGCGTATAGTG CD126 M5 AHS0096 AATGGTGAATCGCCCTAGCAAGTGGTATCGGAATCG CD30 BERH8 AHS0114 CCAGTGTAGATTGAGCCGTCGATTTAGTTAGCAGTG CD40 5C3 AHS0117 GGTGTAATTGGGCTAGAACGTATATGCGGTAAGGCG CD138 MI15 AHS0121 TAAGCTGCCGGTATTGGAAACGTATCGATCTATTGG CD79B CB3-1 AHS0153 CATCATGAGTAGTTGCTTCGGCGAGTAGGTTTAATT CD22 HIB22 AHS0195 TGGTTCGTGACTGTATAGGCTTAGCTTAGGCAATTT IgM G20-127 AHS0198 TTTGGAGGGTAGCTAGTTGCAGTTCGTGGTCGTTTC CD43 1G10 AHS0200 ATGGCGGATGGATTTGTCGGTGATATTGCTCTCGTT CD268 (BAFF-R) 11C1 AHS0206 TGTGAATGAGTTAAGCGTCGCGGATATGTAGAGCCT CD23 EBVCS-5 AHS0210 TTTGATGTGGGCGGGTTGTATTACGGTTTCGAGTCT CD73 AD2 AHS0216 AAAGTAGGGTCGATCAAGGGAGTTAACGGTAGCGCT CD1d CD1d42 AHS0219 GTTAGGATTATTGACGTACCGAGTTAGGAGTGATTG
Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
1. This reagent is provided lyophilized in a pre-titrated format.
2. Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses.
5. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste.
6. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
7. For U.S. patents that may apply, see bd.com/patents.
8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
