Description
Note: The protocol supports the Ab-Oligos labeling of 1−2 million cells per tube. 1. Remove one tube of BD® OMICS-One T-Cell Protein Panel, one tube of BD® OMICS-One B-Cell Protein Panel, and one tube of BD® OMICS-One Tumor Protein Panel from foil bags and bring up to room temperature for 5 minutes. 2. Make sure all pellets are located at the bottom of the tubes. If not, briefly centrifuge to collect the contents at the tube bottom. 3. For each tube, add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibody immediately before cell staining. Prolonged incubation of reconstituted antibody may increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 25 plex or lower, prepare the BD® AbSeq labeling MasterMix in 1.5-mL LoBind tube on ice. The following calculation is for the procedure with Optional Fc Block. If Fc Block is not performed, add 25 µL BD Pharmingen™ Stain Buffer (FBS) to the Abseq labeling MasterMix total volume for each sample. Note: For drop-in with more than 25 plex, reach out to technical support for the calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS† (catalog number 554656) 70 – (2.0 x N) 91 – (2.6 x N) 182 – (5.2 x N) Total 70 91 182 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS† (catalog number 554656) 50 – (2.0 × N) 65 – (2.6 × N) 130 – (5.2 × N) Total 50 65 130 * N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. † FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, combine the three tubes containing 35 µL reconstituted T-Cell Protein Panel solution, 35 µL reconstituted B-Cell Protein Panel solution, and 35 µL reconstituted Tumor Protein Panel solution. Then add 70 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 105 µL reconstituted T-Cell, B-Cell, and Tumor Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, combine the three tubes containing 35 µL reconstituted T-Cell Protein Panel solution, 35 µL reconstituted B-Cell Protein Panel solution, and 35 µL reconstituted Tumor Protein Panel solution. Then add 50 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing total 105µL reconstituted T-Cell, B-Cell, and Tumor Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. If Fc Block is not used. skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (catalog number 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component 1 sample (µL)* 1 sample + 20% overage (µL) FBS† (catalog number 554656) 20.0 24.0 Fc Block‡ (catalog number 564220) 5.0 6.0 Total 25.0 30.0 * Sufficient for up to 1 million cells. To block more cells, adjust the volume. † FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block = BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 µL. Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 x g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. Refer to the BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8 minute incubation) as follows: a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. Place the cartridge on the BD Rhapsody™ HT Xpress and perform the On-Cartridge Wash steps listed as follows: _____________________________________________________________ Material to load Volume (µL) 1 lane Pipette Mode Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One T-Cell panel: _____________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence CD103 Ber-ACT8 AHS0001 AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT CD137 4B4-1 AHS0003 TGACAAGCAACGAGCGATACGAAAGGCGAAATTAGT CD45RA HI100 AHS0009 AAGCGATTGCGAAGGGTTAGTCAGTACGTTATGTTG CD69 FN50 AHS0010 CAATAACGGGTCATAGTAAGTCGCGAGTAAGAGGGC CD278 DX29 AHS0012 ATAGTCCGCCGTAATCGTTGTGTCGCTGAAAGGGTT CD134 (OX40) ACT35 AHS0013 GGTGTTGGTAAGACGGACGGAGTAGATATTCGAGGT CD279 (PD-1)† EH12.1 AHS0014 ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD366 (TIM-3) 7D3 AHS0016 TAGGTAGTAGTCCCGTATATCCGATCCGTGTTGTTT CD223 (Lag3) T47-530 AHS0018 CGGCATGAATTAGGCGAGACTTAGTATACGAGCTGG CD95 (Fas) DX2 AHS0023 GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD25 2A3 AHS0026 AGTTGTATGGGTTAGCCGAGAGTAGTGCGTATGATT CD127 HIL-7R-M21 AHS0028 AGTTATTAGGCTCGTAGGTATGTTTAGGTTATCGCG CD183 1C6/CXCR3 AHS0031 AAAGTGTTGGCGTTATGTGTTCGTTAGCGGTGTGGG CD4 SK3 AHS0032 TCGGTGTTATGAGTAGGTCGTCGTGCGGTTTGATGT CD196 (CCR6) 11A9 AHS0034 ACGTGTTATGGTGTTGTTCGAATTGTGGTAGTCAGT CD45RO UCHL1 AHS0036 TGAGAGGTTATTGGGCGTATGACTTCGGTGATTGTG CD194 (CCR4) 1G1 AHS0038 AATATTAGTGGGTCCTCGCGTTGGCCGGTTGTTAGT CD62L DREG-56 AHS0049 ATGGTAAATATGGGCGAATGCGGGTTGTGCTAAAGT CD272 J168-540 AHS0052 GTAGGTTGATAGTCGGCGATAGTGCGGTTGAAAGCT CD154 TRAP1 AHS0077 TAAGAGGTAAGTGCATTCGGGTATAGGCGTGATTTG CD357 (GITR) V27-580 AHS0104 TCTGTGTGTCGGGTTGAATCGTAGTGAGTTAGCGTG CD28 L293 AHS0138 TTGTTGAGGATACGATGAAGCGGTTTAAGGGTGTGG TCRgd 11F2 AHS0142 CTCGTGGGTTAGGCTTGATCGTAGTTATGTATGGTT CD44† L178 AHS0167 GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG TCR Va24-Ja18 6B11 AHS0175 TTCTGGTTCGGTTGAGCTACTAATTTCGTTGGATGG CD161 (KLRB1) HP-3G10 AHS0205 TTTAGGACGATTAGTTGTGCGGCATAGGAGGTGTTC CD8 SK1 AHS0228 AGGACATAGAGTAGGACGAGGTAGGCTTAAATTGCT CD3 UCHT1 AHS0231 AGCTAGGTGTTATCGGCAAGTTGTACGGTGAAGTCG CD197 (CCR7) 2-L1-A AHS0273 AATGTGTGATCGGCAAAGGGTTCTCGGGTTAATATG TIGIT tgMab-2 AHS0411 AGAGGGTTTAGTCAAGGTCGTGCGTATAGTTCAGGT List of all 30 Human AbSeq specificities included in the BD® OMICS-One B-Cell Panel: _____________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence CD20 2H7 AHS0008 TTGCTTGTTGCGCGTTAGAGAGTATGTCGGGAGATG CD275 2D3/B7-H2 AHS0011 GTTTATATGTACGACGCCCGGTTGACGAGTGGAAGT CD38 HIT2 AHS0022 GTCAACGATGGGTAGCGGTAGAAATAACGGAACTGG CD95 DX2 AHS0023 GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD27 M-T271 AHS0025 TGTCCGGTTTAGCGAATTGGGTTGAGTCACGTAGGT CD19 SJ25C1 AHS0030 TAGTAATGTGTTCGTAGCCGGTAATAATCTTCGTGG HLA-DR G46-6 AHS0035 TGTTGGTTATTCGTTAGTGCATCCGTTTGGGCGTGG CD185 (CXCR5) RF8B2 AHS0039 AGGAAGGTCGATTGTATAACGCGGCATTGTAACGGC CD24‡ ML5 AHS0042 ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT CD80 L307.4 AHS0046 GAGGGTAACGGGTGTCCAAATATCGGCTGTGTAAGT CD5 UCHT2 AHS0047 ACGAAGCGAGCGAAGAACCTATGCGATTGAGTAAGT CD10 HI10a AHS0051 CCTGTTTGATGCGTACGGAGATTTAGCGGATTTATG IgD IA6-2 AHS0058 TGAGGGATGTATAGCGAGAATTGCGACCGTAGACTT IgG G18-145 AHS0059 AGGTAGGTTATCGTAGGGTAGACTTAGCGGGCATTG CD184 (CXCR4) 12G5 AHS0060 CAGTGTTTAGAGCGGGTTGCATATGTCGTTTAGAGG CD34‡ 581 AHS0061 TGGGTGTATTACGGTTAGTTTATGCGCGAAGGTGTT CD21 B-ly4 AHS0074 GTATTCGCGTATTGTCAGTCGGTAGGGTTATGGTCT CD9 M-L13 AHS0082 GGGTTGTAAGTCGTCGGAAGTGTGAAGCGTATAGTG CD126 M5 AHS0096 AATGGTGAATCGCCCTAGCAAGTGGTATCGGAATCG CD30 BERH8 AHS0114 CCAGTGTAGATTGAGCCGTCGATTTAGTTAGCAGTG CD40 5C3 AHS0117 GGTGTAATTGGGCTAGAACGTATATGCGGTAAGGCG CD138 MI15 AHS0121 TAAGCTGCCGGTATTGGAAACGTATCGATCTATTGG CD79B CB3-1 AHS0153 CATCATGAGTAGTTGCTTCGGCGAGTAGGTTTAATT CD22 HIB22 AHS0195 TGGTTCGTGACTGTATAGGCTTAGCTTAGGCAATTT IgM G20-127 AHS0198 TTTGGAGGGTAGCTAGTTGCAGTTCGTGGTCGTTTC CD43 1G10 AHS0200 ATGGCGGATGGATTTGTCGGTGATATTGCTCTCGTT CD268 (BAFF-R) 11C1 AHS0206 TGTGAATGAGTTAAGCGTCGCGGATATGTAGAGCCT CD23 EBVCS-5 AHS0210 TTTGATGTGGGCGGGTTGTATTACGGTTTCGAGTCT CD73 AD2 AHS0216 AAAGTAGGGTCGATCAAGGGAGTTAACGGTAGCGCT CD1d CD1d42 AHS0219 GTTAGGATTATTGACGTACCGAGTTAGGAGTGATTG List of all 30 Human AbSeq specificities included in the BD® OMICS-One Tumor panel: _____________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence CD274 (PD-L1) MIH1 AHS0004 ATCGTAAGGCTCGTGGTTCGTAAGTAAGTTCGTATC CD279 (PD-1)† EH12.1 AHS0014 ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD45 HI30 AHS0040 GTGCGAAATGGCGGAATGTTATCTGCGAATGTAGTC CD324 (E-cad) 67A4 AHS0041 GATATGAATGGGTTGCGGTGTAAAGTCGTAATGGTT CD24‡ ML5 AHS0042 ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT CD90 5E10 AHS0045 GACTATATGTACGGTGTTAATTCGGGATCCTGCGCT CD34‡ 581 AHS0061 TGGGTGTATTACGGTTAGTTTATGCGCGAAGGTGTT CD117 YB5.B8 AHS0064 GGATTAGTTGTCGTTATAGGGAGTGCGTTCTTAGCG HLA-A,B,C G46-2.6 AHS0066 GATATGCATGGCGAGTAGGTAGAACGAAGCTTAGGT CD54 HA58 AHS0076 AAGAGAATATATGCGTGCGTTGTTAAGGGAATGCGT CD29 MAR4 AHS0080 TGGTAAGGTGGTTGCGAGTAAGTAGCGGTGAGTTGT CD47 B6H12 AHS0087 TGTTAGGTTCGACGTATTATGTGTAGATCCGCAAGG CD326 (EpCam) EBA-1 AHS0089 TTGAGCGTAAAGTTGCGTCCGGTAATTGAGTTGCGT CD66 B1.1/CD66 AHS0094 GTCTGCGCAAGGTAAGCTAAGTAACGAAAGGGATCT CD133 W6B3C1 AHS0103 TTTGGTATTGGCACGGTTTGTAGCGAGTTGACGGTC CD26 M-A261 AHS0109 TGTAGGTTGCGCGGTTATTAGGGTATTATCGATCTG CD155 TX24 AHS0111 GCGGTGGATCGATGGGTATAGTTGGTAATTTGCGTC CD146 P1H12 AHS0127 AGGTTATTTAGGTGACGGTTGTATTGACGAGAGAGG C-MET 3D6 AHS0132 AGCGTGAGTTGTCGGTAGTTAATTATCGGAGAGTTT ITGRN BTA 7 FIB504 AHS0158 TTTCAGTTTGGTCGCAGTTAAGGTATCGTATGGGTC CD44† L178 AHS0167 GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG PECAM1 (CD31) WM59 AHS0170 CTAAGGGACGTAATTGAGTTTCGGTGATCGCAGTTT EphB2 2H9 AHS0176 TATTGCGGGTAGGATTTGTCTCGAAGCGTAGGTAGC Vista MIH65.RMAB AHS0187 ATCAGGGAATCTCGGTAAGTTAAACGTGTATAGTGC PDPLN LPMAB-17 AHS0192 TTTATGAGTATTACGTCTGTTGCGATTGTTGGCGGT NOTCH1 MHN1-519 AHS0214 CGTAGTAGGAGCGTGTTTCATCGGCATTATCGTTTG CD325 (n-Cad) 8C11 AHS0223 TAGGATGAGTTTCGTAAGTAAGGTAGTCGTATGGCT CD58 1C3 AHS0237 TTGGTGAGTATTGGTGCGTAGTATGCGGGATGTTTG EGFR EGFR.1 AHS0241 ATATGATTGATGCGGGTTAGCCTACAGATTCGAGTT CD227 (MUC1) HMFG2 AHS0247 AGTGCATGGTTAGTAGGTGTGAGTCGTTAGATATTC * T-Cell and B-Cell Protein Panels contain the same CD95 antibody. † T-Cell and Tumor Protein Panels contain the same CD279 (PD-1) and CD44 antibody. ‡ B-Cell and Tumor Protein Panels contain the same CD24 and CD34 antibody.
Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
1. Please refer to www.bdbiosciences.com/us/s/resources for technical protocols.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
5. For U.S. patents that may apply, see bd.com/patents.
6. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste.
7. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses.
8. This reagent is provided lyophilized in a pre-titrated format.
