Qiagen, 940065, KF Flex 24 DNA Blood Reagents (96)
Catalog Number: 940065
Send an RFQ.
Category
Loading…
Send an RFQ for Qiagen 940065, KF Flex 24 DNA Blood Reagents (96). Iright supports global sourcing and international shipment for life science and laboratory products.
| Brand | BD™ AbSeq |
|---|---|
| Alternative Name | Integrin β3; Integrin beta-3; GP3A; GPIIIa; ITGB3; ITB3 |
| Entrez Gene ID | 3690 |
| Vol. Per Test | 2 µl |
| Isotype | Mouse IgG1, κ |
| Reactivity | Human (Tested in Development) |
| Application | Single Cell 3' Sequencing (Qualified) |
| Barcode Sequence | CGGGTTTAAGGATTGCGTTCGTCGGTAGTAGTGAGT |
| Sequence ID | AHS0069 |
| Storage Buffer | Aqueous buffered solution containing BSA and ≤0.09% sodium azide. |
| Regulatory Status | RUO |
| Host Species | Mouse |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
