Biolegend, 109853, TotalSeq™-A0157 anti-mouse CD45.2 Antibody
10microg
Catalog Number: 109853
Loading…
| Verified Reactivity | Mouse |
|---|---|
| Antibody Type | Monoclonal |
| Host Species | Mouse |
| Immunogen | B10.S mouse thymocytes and splenocytes |
| Formulation | Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA |
| Preparation | The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. |
| Concentration | 0.5 mg/ml |
| Storage & Handling | The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze. |
| Application | PG - Quality tested |
| Recommended Usage | Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
| Application Notes | The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation4, in vivo and in vitro blocking of B cell responses1,2, and immunohistochemical staining of acetone-fixed frozen sections3. |
|---|
| Additional Product Notes | TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq. The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Scientific Poster Library. |
|---|
| Application References(PubMed link indicates BioLegend citation) | Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block) Yakura H, et al. 1986. J. Immunol. 136:2729. (Block) Suzuki K, et al. 2000. Immunity 13:691. (IHC) Shen FW, et al. 1986. Immunogenetics 24:146. (IP) Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837. Pascal V, et al. 2007. J. Immunol. 179:1751. Burman AC, et al. 2007. Blood 110:1064. Kincaid EZ, et al. 2007. J. Immunol. 179:3187. Phan TG, et al. 2007. Nature Immunol. 8:992. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed Wen T, et al. 2013. PNAS. 110:6067. PubMed Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed |
|---|
| Product Citations | Van Hoof R, et al. 2022. Int J Mol Sci. :23. PubMed Peng C, et al. 2022. Immunity. 55:98. PubMed |
|---|
| RRID | AB_2783051 (BioLegend Cat. No. 109853) |
|---|
| Structure | Protein tyrosine phosphatase (PTP) family, 180-240 kD |
|---|
| Distribution | All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice |
|---|
| Function | Phosphatase, T and B cell activation |
|---|
| Ligand/Receptor | Galectin-1, CD2, CD3, CD4 |
|---|
| Biology Area | Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers |
|---|
| Molecular Family | CD Molecules |
|---|
| Antigen References | 1. Suzuki K, et al. 2000. Immunity 13:691. |
|---|
| Gene ID | 19264 |
|---|
| UniProt | View information about CD45.2 on UniProt.org |
|---|
| Clone | 104 |
|---|
| Regulatory Status | RUO |
|---|
| Other Names | Ly-5.2, LCA |
|---|
| Isotype | Mouse (SJL) IgG2a, κ |
|---|
| Barcode Sequence | CACCGTCATTCAACC |
|---|
