Biolegend, 127227, TotalSeq™-A0077 anti-mouse CD73 Antibody
10microg
Catalog Number: 127227
Send an RFQ.
Category
Loading…
| Verified Reactivity | Mouse |
|---|---|
| Antibody Type | Monoclonal |
| Host Species | Rat |
| Immunogen | CHO cells transfected with mouse CD73 |
| Formulation | Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA |
| Preparation | The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. |
| Concentration | 0.5 mg/ml |
| Storage & Handling | The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze. |
| Application | PG - Quality tested |
| Recommended Usage | Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
| Additional Product Notes | TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq. The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Scientific Poster Library. |
|---|
| Application References(PubMed link indicates BioLegend citation) | Yamshita Y, et al 1998. Eur. J. Immunol. 28:2981. Bentley JK, et al. 2010. Respir. Res. 11:127. (IHC-P) |
|---|
| RRID | AB_2749980 (BioLegend Cat. No. 127227) |
|---|
| Structure | 69 kD GPI-anchored surface protein |
|---|
| Distribution | Positive on most CD11b+ myeloid cells in bone marrow, but not on CD11b+ peripheral cells; a large proportion of CD4+ and CD8+ splenic T cells express CD73 |
|---|
| Function | A nucleotidase catalyzing the dephosphorylation of extracellular nucleoside 5' monophosphates |
|---|
| Ligand/Receptor | Nucleoside 5' monophosphate |
|---|
| Cell Type | B cells, Mesenchymal Stem Cells, Tregs |
|---|
| Biology Area | Costimulatory Molecules, Immunology, Stem Cells |
|---|
| Molecular Family | CD Molecules |
|---|
| Antigen References | 1. Yamashita Y, et al 1998. Eur. J. Immunol. 28:2981. 2. Resta R, et al. 1998. Immunol. Rev. 161:95. |
|---|
| Regulation | Expression is regulated by the development and maturation of leukocytes |
|---|
| Gene ID | 23959 |
|---|
| UniProt | View information about CD73 on UniProt.org |
|---|
| Clone | TY/11.8 |
|---|
| Regulatory Status | RUO |
|---|
| Other Names | Ecto-5'-nucleotidase |
|---|
| Isotype | Rat IgG1, κ |
|---|
| Barcode Sequence | ACACTTAACGTCTGG |
|---|
