Biolegend, 336237, TotalSeq™-D0407 anti-human CD36 Antibody
10microg
Catalog Number: 336237
Send an RFQ.
Category
Loading…
| Verified Reactivity | Human |
|---|---|
| Antibody Type | Monoclonal |
| Host Species | Mouse |
| Immunogen | Human platelets |
| Formulation | Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA |
| Preparation | The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions. |
| Concentration | 0.5 mg/mL |
| Storage & Handling | The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze. |
| Application | PG – Quality tested |
| Recommended Usage | Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
| Application Notes | Additional reported applications (for the relevant formats) include: immunofluorescence2. |
|---|
| Additional Product Notes | TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes. |
|---|
| Application References(PubMed link indicates BioLegend citation) | Stelner E, et al. 2006. J. Cell Sci. 119:459. Stewart DA, et al. 2012. Mol. Cancer Res. 10:727. (IF) |
|---|
| RRID | AB_2904359 (BioLegend Cat. No. 336237) |
|---|
| Structure | Integral membrane protein, CD36 family, single chain glycoprotein, 85-113 kD |
|---|
| Distribution | Expressed in various epithelial and endothelial cells, erythrocytes, platelets, monocytes/ macrophages, some macrophage-derived dendritic cells |
|---|
| Function | Scavenger receptor for thrombospondin, long chain fatty acids, anionic phospholipids, oxidized LDL, collagen types I, IV and V. Involved in recognition and phagocytosis of apoptotic cells, cell adhesion. |
|---|
| Ligand/Receptor | Thrombospondin, anionic phospholipids, oxidized LDL, collage types I, IV, and V |
|---|
| Cell Type | Dendritic cells, Endothelial cells, Epithelial cells, Erythrocytes, Macrophages, Monocytes, Platelets |
|---|
| Biology Area | Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience |
|---|
| Molecular Family | CD Molecules |
|---|
| Antigen References | 1. Hogg N, et al. 1984. Immunology 53-753. 2. Greenwalt DE, et al. 1992. Blood 80:1105. 3. Armsesilla AL, et al.1994. J. Biol. Chem. 269:18985. 4. Endemann G, et al. 1993. J. Biol. Chem. 268:11811. |
|---|
| Gene ID | 948 |
|---|
| UniProt | View information about CD36 on UniProt.org |
|---|
| Clone | 5-271 |
|---|
| Regulatory Status | RUO |
|---|
| Other Names | gpIIIb, gpIV |
|---|
| Isotype | Mouse IgG2a, κ |
|---|
| Barcode Sequence | TTCTTTGCCTTGCCA |
|---|
