Merck, EHNC010881-20UG, MISSION® esiRNA
Size:20 μg, targeting human COQ8A
Available Catalog Numbers
Catalog Number: EHNC010881-20UG
Send an RFQ.
Category
Pack Size20 µg
Loading…
| NACRES | NA.51 |
|---|---|
| UNSPSC Code | 41105324 |
| product line | MISSION® |
| form | lyophilized powder |
| esiRNA cDNA target sequence | CACCAGGTGATTGAAGCAGAGAAACTTAGGTGGTGAAAGGAGAAGATGGGGCCTGTCCTGAGAGTTTCTGTTCCTGAGATGCTAGAGGCAGAGGGTCCCTAAACTTTCCTGAGTCGGCAGACATCCCCTCTGGAGAAGAGGTTGGCCCCAGAGTCGAACATCCTCTGATCTACCTGATCCTGCTGCCCTTCCATTCCACTTCCCCACATCTGTTCTTTCTGGTCGTGTTTACTCCCCTATTAAAAAAACAAAACCAGAAAACGTGTTTGCCTAGATCTTGAGACTCTGGAAGATCTTAACAGTCAGAGGTTCCCCCTATTTGCAATGATCTCCTTTCCTGCCCCTTCCTATC |
| GenBank accession no. | AI332475 |
| shipped in | ambient |
| storage temp. | −20°C |
| Gene Information | human ... COQ8A(56997) |
Unless otherwise stated, the minimum order amount is USD 1,000.
For orders below USD 1,000, an additional handling fee may apply, or we may arrange local delivery / local handover where available.
All quotations are subject to final confirmation, including product availability, lead time, batch information, shipping cost, and applicable export or handling requirements.
For quotation requests, please send an RFQ from website or contact:
Please send inquiries directly to us in the “To” field. Emails sent via BCC, mass mailing, or with unrelated recipients may be automatically filtered and will not be processed.
